translate

CodonTable to be used (defaults to Standard)

defaults to False meaning do a full translation continuing on past any stop codons (translated as the specified stop_symbol). If True, translation is terminated at the first in frame stop codon (and the stop_symbol is not appended to the returned protein sequence).

If True, this checks the sequence starts with a valid alternative start codon (which will be translated as methionine, M), that the sequence length is a multiple of three, and that there is a single in frame stop codon at the end (this will be excluded from the protein sequence, regardless of the to_stop option). If these tests fail, an IllegalStateException is raised.

val codingDNA = NucSeq("GTGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG")
println(codingDNA.translate())                                      //VAIVMGR*KGAR*
println(codingDNA.translate(to_stop = true))                        //VAIVMGR
val mitoTable = CodonTable(2)
println(codingDNA.translate(table = mitoTable))                     //VAIVMGRWKGAR*
println(codingDNA.translate(mitoTable, to_stop = true))             //VAIVMGRWKGAR

//With CDS true, it then checks for alternative start and GTG is converted to M
println(codingDNA.translate(mitoTable, to_stop = true, cds = true)) //MAIVMGRWKGAR

Ambiguous nucleotides are not supported and will throw errors